Cell-targeted phagemid particles preparation using Escherichia coli bearing ligand-pIII encoding helper phage genome.

Benchmarks The filamentous phages M13, f1, and fd have been widely applied in biological research such as phage display library, phage gene delivery, and antigen preparation (1). For phagemid-mediated gene delivery, we have previously reported that modified helper phage M13KO7P1, which encodes a 12-mer ligand peptide and pIII fusion, could be used to rescue phagemid that encodes the gene of interest (2). The phagemid particles display a high level of peptide. Moreover, the phagemid is not necessary to encode the pIII protein and therefore leaves a larger space for cloning genes of interests. Since the size of phagemid particle is directly proportional to the size of the phagemid genome as previously described (3), the modified phagemid particles are expected to be smaller than those prepared using other methods. The reduced size of the gene delivery particle might enhance its penetration capacity when used in in vivo gene delivery. However, the yield of M13KO7P1 helper phage is relatively low, 3.4 × 10 9 plaque-forming units (pfu)/mL (2). When helper phage is modified with a moderate size ligand, such as epidermal growth factor (EGF), the yield of the helper phage is even much lower, 1.5 × 10 8 pfu/mL (unpublished data). To solve this problem, we made LMP cells by transforming EGF-modified helper phage genome (plasmid) into F + bacterial cells. The phagemid encoding genes of interest was then transformed into the LMP cells to make phagemid particles. EGF-modified helper phage genome M13EGFKO7CT: EGF encoding sequence was amplified from pAE-8 (4) using primers M13EGF-1: 5′-CGGG TAC C T T T C TAT T C T C AC T C TA ATTCCGACTCTGAATGCCC-3′ and M13EGF-2: 5′-GTTTCGGC GAACCTCCACCACGCAGTTCCC ACCATTTC-3′, thus generating DNA fragment 1. The DNA fragment 2 was amplified from M13KO7 using primers CT-1: 5′-CTGCGTGGTGG AGGTTCGGCTAGCGGTGGTGGCT CTGGTTCCGGT-3′ and CT-2: 5′-CGCGCAGAGGCGAATTATTC-3′. DNA fragment 3 was obtained by assembly PCR using DNA fragment 1 and 2 as template. The DNA fragment 3 encodes EGF-pIIICT (fusion protein of EGF and the carboxyl domain of protein III). DNA fragment 3 was digested with KpnI and PacI and then ligated into M13KO7P1 (2) KpnI/PacI-digested backbone. Since the restriction site of KpnI was located in the leader sequence of peptide-pIII, no peptide-pIII encoding sequence remained in the backbone.